How to replace multiple integers at once

[lel7lel7]

Hi, i am new to python and having some problems...

I am trying to figure out how to change multiple integers at once so i can produce the complement of this DNA strand...
>>>dna = """tgaattctatga atggactgtccccaa agaagtaggacccac taatgcagatcctgg a
tccctagctaagatg tattattctgctgtg aattcgatcccacta aagat"""
(ie. acttaagatactt.. ...)

I have learnt how to remove \n character using
>>> dna = replace(dna, ’\n’, "”)
but i cannot figure out how to write a script that will change t to a, a to t, g to c and c to g.

If i change them individually
>>> dna = replace(dna, ’a’, "t”)
then all the a's do become t's then the true t's cannot be distinguished. I then thought of making them w,x,y,z then changing them to the complent but that also takes too much time.

is there some way to write
>>> dna = replace(dna, 'a', "t") and replace(dna, 't', "a")...and so on so it will change all 4 at once???

Any help would be greatly appreciated :)
Thanks, Lel

[bvdet]

You meant "characters " instead of "integers"? Define a conversion dictionary and use a the string join() method and a list comprehension to convert each letter in succession. A string is a type of sequence. We can also skip the newline and any other invalid character.

dd = {"t": "a", "a": "t", "g": "c", "c": "g"}
dna = """
tgaattctatgaatggactgtccccaaagaagtaggacccactaatgcagatcctggatccc
tagctaagatgtattattctgctgtgaattcgatcccactaaagat
"""
dnacomp = "".join([dd[s] for s in dna.strip() if s in "atcg"])
print dnacomp

The output:

>>> acttaagatacttacctgacaggggtttcttcatcctgggtgattacgtctaggacctagggatcgattctacataataagacgacacttaagctagggtgatttcta
>>>

[lel7lel7]

Ok thanks, i dont really understand the dnacomp command but ill look back at it when im further through the training manual.
As a simple way ive figured out that it can be done using

>>>replace(repl ace(replace(rep lace(dna, 'a', "T"), 't', "A"), 'g', "C"), 'c', "G")

but im assuming this format will not be sufficient when im trying to write harder scripts

Thanks again :)

[bvdet]

It is not a command, but an assignment. I assigned a str object to an identifier named dnacomp using string method join(), a dictionary, and a list comprehension. Here's another way to accomplish the same thing:

dd = {"t": "a", "a": "t", "g": "c", "c": "g"}
temp = []
for s in dna.strip():
    if s in "atcg":
        temp.append(dd[s])
dnacomp = "".join(temp)

This uses str method replace() similar to your code.

dnacomp = dna.replace('a', "T").replace('t', "A").replace('g', "C").replace('c', "G").replace("\n", "").lower()

[lel7lel7]

Basic python question

Ok, im still learning and this is all making sense except one thing...
Above you write "for s in dna.strip().... " I am trying to understand what 's' represents. Is 's' the dictionary? and does it always have to be this character or can i assign any random one?

In other words, do 's' and (as below) 'l' , 'k' and 'i' have their own function?

The reason i ask is because I am trying to understand the function below but i get the following error...

>>> def digests(enzymes):
	digests = []
	for i in range(len(enzymes)):
		for k in range (i+l, len(enzymes)):
			digests.append( [enzymes[i], enzymes[k]] )
		return digests

Traceback (most recent call last):
File "<pyshell#1 8>", line 4, in digests
for k in range (i+l, len(enzymes)):
NameError: global name 'l' is not defined

[bvdet]

"s" represents the current item of the sequence dna.strip() in the for loop. Maybe this example will clear it up:

>>> for s in "string":
... 	print s
... 	
s
t
r
i
n
g
>>> s
'g'
>>> for item in [1,2,3,4,5]:
... 	print item
... 	
1
2
3
4
5
>>> item
5
>>>

[lel7lel7]

Ahh i see now. Thank-you again!!
:)

[Glenton]

Although bvdet's solution is brilliant, as always, it is relatively standard in coding to swap things by having an inbetween step like your upper-case letters. eg to swap a and b, you go x=a, a=b, b=x.

In python this can be done better though with:

a,b=b,a

e.g.

In [21]: a=1

In [22]: b=2

In [23]: a,b=b,a

In [24]: a
Out[24]: 2

In [25]: b
Out[25]: 1

[lel7lel7]

HI Glenton,
I understand what your saying but am having trouble working it...

dna = "AAATTTCCCGGG"
a = "A"
b = "T"
c = "G"
d = "C"
dd = a,b=b,a
ddd = c,d=d,c
seq = []
for x in dna.strip():
if x in "ATGC":
seq.append(dd[x]).append(ddd[x])
return dna
dnacomp = "".join(seq)

obviously this doesnt work.. ive tried a few other ways also but cannot figure it out

Thanks for your help :)

[Glenton]

Okay, so what you want to do is replace t to a, a to t, g to c and c to g.

In [1]: dna="tgactgacgatgctagct"

In [2]: dna=dna.replace("t","x")

In [3]: dna=dna.replace("a","t")

In [4]: dna=dna.replace("x","a")

In [5]: dna
Out[5]: 'agtcagtcgtagcatgca'

and swapping g and c is similar.

[woooee]

but i cannot figure out how to write a script that will change t to a, a to t, g to c and c to g.

Perhaps using a dictionary and looking at each character individually will be easier to understand. A link to an online book's description of a dictionary http://www.greenteapress.com/thinkpy...l/book012.html

dna = """tgaattctatgaatggactgtccccaaagaagtaggacccactaatg cagatcctgga 
tccctagctaagatgtattattctgctgtgaattcgatcccactaaagat """

changes_dict = {"t":"a", "a":"t", "g":"c", "c":"g" }

##   it is more efficient to append to a list and join()
##   rather than concatenating a string each time
new_dna = []
for ch in dna:
    if ch in changes_dict:
        new_dna.append(changes_dict[ch])  ## new character
    else:
        new_dna.append(ch)     ## original character
new_dna_str = "".join(new_dna)
print new_dna_str