Code:
if(x > screen_x or x < 0 or y > screen_y or x < 0): if(x > screen_x or x < 0 or y > screen_y or y < 0): <=====
woooee
Last Activity: May 14 '10, 06:42 PM
Joined: Mar 13 '08
Location:
-
Start with this -
Since you are sorting numbers, you want to convert to a float as well. Strings sort left to right, so "10" will sort before "2", because "1" is less than "2". Note that floats have limited precision so can be slightly different than the original number but work fine for "normal" calculations....Code:a = [] line = "0001 , 4 , 0.34 , 3 , 15 , 25.3" a.append(line.split(','))Leave a comment:
-
+1 on opening it as a normal file and splitting on the comma. Also, check the length of each split record before doing anything else. You should not rely on their not being any empty or malformed records in the file.Leave a comment:
-
Perhaps using a dictionary and looking at each character individually will be easier to understand. A link to an online book's description of a dictionary http://www.greenteapress.com/thinkpy...l/book012.html...Code:dna = """tgaattctatgaatggactgtccccaaagaagtaggacccactaatg cagatcctgga tccctagctaagatgtattattctgctgtgaattcgatcccactaaagat """ changes_dict = {"t":"a", "a":"t",Leave a comment:
-
You would use a function to compare the columns, but since you are unwilling or unable to even give that a try, there is an even easier-to-understand way. Create a second list with each element containing two tuples. The first tuple contains only the columns that you want to sort in the order that you want to sort them (4 elements each). The second tuple contains the original record (6 elements each). You sort normally and will have the entire...Leave a comment:
-
From the Python Sort Wiki...Leave a comment:
-
l is a list of pointers to individual instances of the memb (Member) class, so you should look at the forename that each instance points to, and check what you are doing at the same time. Please don't use "i", "l", " or "O" as single letter variable names because they look too much like numbers. Untested code =...Code:def delete_player(forename): """ Delete a member from the listLeave a comment:
-
Whenever you are doing anything similar, always check for the proper length and print if it's not correct. You will eliminate a lot of unnecessary debugging.
Code:x = line.split(";") if len(x) > 8: ## process normally else: print("Bogus line length =", x)Leave a comment:
-
sleep() of course has to check the time periodically to see if it should wake up. If you can, submit the program every 15 minutes to the host, run and exit.Leave a comment:
-
You will have to post the error message which lists the line that contains the error. My guess is that you have a record with less than 9 items.Leave a comment:
-
Check the number of left parens and right parens in this statement. I good IDE will assist with closing any punctuation you begin.Code:f = csv.writer(open("text2.txt" , "w").writerow(str(result))Leave a comment:
-
You want to first count the number of asterisks; that will be the cut-off. Next, compare the given word to all possibles. To allow for two letters that are the same, say a word has two "o"s for example, sort both words and compare with a loop, comparing each letter in turn. Increment through the word if a letter is found.
You can also use lists, which is probably easier. Use the first word as the control. Convert the...Leave a comment:
-
Second column would just be row[2]. I don't understand the rest of the question (do you want row[2] output to be conditioned on row[7]?) so you should provide some sample data to clarify....Leave a comment:
-
Pass the sequence to a function which returns the updated sequence. You can do this from the while loop and anywhere else in the program you want, providing the function is defined before the code calling it (the norm is to declare all functions first with the body of the code following).Leave a comment:
-
Sets do thatCode:a = set(['a', 'b', 'c']) b = set(['c', 'a']) print b.issubset(a)
Leave a comment:
-
If you comment all lines that reference Person.populati on in __del__, it works also, at least as much as I have played with it....Leave a comment:
-
It has to do with the __del__ function trying to print Person.populati on after it has been garbage collected. I do not know why this is, but perhaps has to do with reducing the counter in __del__ (as the class is destroyed) when the program exits.
Edit: If you remove the class instances yourself, then it runs correctly...Code:## add this code at the end ## "de-stantiate" (just kidding) swaroop = NoneLeave a comment:
-
Read the file one record at a time as you would normally do. When you reach a "Description=st ring:" record, append each record to a list until the next "Description=st ring:" record is found. if you want to retain the records in the list, copy them to a file or whatever, then empty the list, rinse and repeat.Leave a comment:
-
Antiword will convert to a text file (I'm assuming that is latin-1). It is available for most operating systems. Don't know which OS you are using, so can't point to the specific page for the OS http://www.winfield.demon.nl/#WindowsLeave a comment:
-
You can store a variable in a dictionary
a=5
test_dict["a"]=a
print test_dict["a"] prints 5
You can instead store the data in the dictionary since test_dict["a"] points to a points to 5, it is just as easy to store the value 5 as test_dict["a"]
You can also do test_dict[a]=3 and print a, test_dict[a] would print 5 3
or b = test_dict["a"], print b...Leave a comment:
No activity results to display
Leave a comment: