numbering sequence

[DARFOUR]

I want additional python codes that will help me generate the second column (the column with numbers) of the output under the
codes. The codes here only generate the first column
by breaking the sequence in cds into threes. Thank you.

>>> cds = "atgagtgaacgtct gagcattaccccgct ggggccgtatatcgg cgcacaataa"

>>> for i in range(0,len(cds ),3):
... print cds[i:i+3],
...
Atg 1
Agt 2
Gaa 3
Cgt 4
Ctg 5
Agc 6
Att 7
Acc 8
Ccg 9
Ctg 10
Ggg 11
Ccg 12
Tat 13
Atc 14
Ggc 15
Gca 16
Caa 17
Taa 18
Taa 19

[bvdet]

Use built-in function enumerate() in conjunction with range(). Also, I would use string formatting for the output.

>>> cds = "atgagtgaacgtctgagcattaccccgctggggccgtatatcggcgcacaataa"
>>> for j,i in enumerate(range(0,len(cds),3)):
... 	print "%s %2s" % (cds[i:i+3], j+1)
... 	
atg  1
agt  2
gaa  3
cgt  4
ctg  5
agc  6
att  7
acc  8
ccg  9
ctg 10
ggg 11
ccg 12
tat 13
atc 14
ggc 15
gca 16
caa 17
taa 18
>>>

[DARFOUR]

Thanks bvdet. I have used your codes and the actually did what I wanted