reversing string in python

[python101]

I intend use string and reverse function to build a simple application in python for DNA (presented by A,G,G, and T) mutation when one of its substring is reversed during the replication process. The reversal happens what are termed inverted pairs. For instance, if the pattern TGAA is later followed byinverted pattern AAGT, the slice of DNA delimited by those patterns could be inverted and reattached. Something's like

TGAACATTAAGT
will be inversed to
TGAATTACAAGT

---------------------------------
The program is simple but I don't know how to manipulate the string to make it be reversed in the way I would like to. Here is my incomplete design:
[code=python]
DNAsequence = raw_input('Plea se enter a DNA sequence :') #First, people have to enter a DNA sequence (A,C,G,T only).
pattern= raw_input('plea se enter the pattern :') # Second, people have to enter the pattern (also A,C,G,T only) this limited to 4 characters.
MutatedDNA ='......' #this is the output I would like to have, a mutated sequence of DNA
[/code]

[ilikepython]

I intend use string and reverse function to build a simple application in python for DNA (presented by A,G,G, and T) mutation when one of its substring is reversed during the replication process. The reversal happens what are termed inverted pairs. For instance, if the pattern TGAA is later followed byinverted pattern AAGT, the slice of DNA delimited by those patterns could be inverted and reattached. Something's like

TGAACATTAAGT
will be inversed to
TGAATTACAAGT

---------------------------------
The program is simple but I don't know how to manipulate the string to make it be reversed in the way I would like to. Here is my incomplete design:
[code=python]
DNAsequence = raw_input('Plea se enter a DNA sequence :') #First people have to enter a DNA sequence (A,C,G,T only).
pattern= raw_input('plea se enter the pattern :') # Second people have to enter the pattern (also A,C,G,T only)
MutatedDNA ='......' #this is the output I would like to have, a mutated sequence of DNA
[/code]

To reverse:
[code=python]
>>> s = "CATT"
>>> s[::-1]
'TTAC'
>>>
>>> ls = list(s)
>>> ls.reverse()
>>> "".join(ls)
'TTAC'
[/code]

[python101]

thank you I got the principle, I will try to see how far I can go.

Anyway, what command(s) should I use if there is another letter rather than A,C,G,T used in the first and second input (if there is a error of inputing, there will be a message appear so user can re-input)?

[ilikepython]

thank you I got the principle, I will try to see how far I can go.

Anyway, what command(s) should I use if there is another letter rather than A,C,G,T used in the first and second input (if there is a error of inputing, there will be a message appear so user can re-input)?

[code=python]
import string
letts = string.lowercas e
letts.remove("a ")
letts.remove("c ")
letts.remove("g ")
letts.remove("t ")

bad = 0
for let in user_input.lowe r():
if let in letts:
bad = 1

... or ...

us = user_input.lowe r()
if us.count("a") + us.count("c") + us.count("g") + us.count("t") < len(us):
bad = 1
else:
bad = 0
[/code]

[python101]

Fished the basic, however, I would like to have something advanced:
- I want to inverse ALL occurrences of the input pattern (if there is more than one) in the DNAsequence. Display the new inversed sequence (other none-inversed in DNA sequence + inversed pattern(s) in proper index as example above, not only the inversed pattern). How can I do so?

[ilikepython]

Fished the basic, however, I would like to have something advanced:
- I want to inverse ALL occurrences of the input pattern (if there is more than one) in the DNAsequence. Display the new inversed sequence (other none-inversed in DNA sequence + inversed pattern(s) in proper index as example above, not only the inversed pattern). How can I do so?

Like this?
[code=python]
seq = "TCGA"
dna = "TCGAGATCTAGTCA TCTAGCTCGATCGAA AGTCTATCGATCGGA T"
print dna.replace(seq , seq[::-1])
[/code]

[python101]

I appreciate your help. Now I'd like to extend the program, instead of inversing the pattern we enter, we inverse the next pattern after the entered pattern. For example

dna = 'TACAAATCGGAC'
pat = 'AATC'

result will be 'TACAAATCACGG'?

[ilikepython]

I appreciate your help. Now I'd like to extend the program, instead of inversing the pattern we enter, we inverse the next pattern after the entered pattern. For example

dna = 'TACAAATCGGAC'
pat = 'AATC'

result will be 'TACAAATCACGG'?

You mean the last part should be 'CAGG'?
[code=python]
def indexList(s, item, i = 0): # Thanks to bvdet for code
i_list = []
while 1:
try:
i = s.index(item, i)
i_list.append(i )
i += 1
except:
break
return i_list

dna = 'TACAAATCGGAC'
pat = 'AATC'

for i in indexList(dna, pat):
nex = dna[i + 4:i + 8]
dna = dna.replace(nex , nex[::-1])
[/code]
See if that works.

[python101]

I have just begun learning python in a few days. Your code looked so complicated for me to understand. Can you explain in more details or can you make the code less complicated?

Like the simple code of ilikepython
[code=python]
>>> s = "CATT"
>>> s[::-1]
'TTAC'
>>> ls = list(s)
>>> ls.reverse()
>>> "".join(ls)
'TTAC'
[/code]
it works well. From this source code, can we extend it to achievement my goal?

[ilikepython]

I have just begun learning python in a few days. Your code looked so complicated for me to understand. Can you explain in more details or can you make the code less complicated?

Like the simple code of ilikepython
[code=python]
>>> s = "CATT"
>>> s[::-1]
'TTAC'
>>> ls = list(s)
>>> ls.reverse()
>>> "".join(ls)
'TTAC'
[/code]
it works well. From this source code, can we extend it to achievement my goal?

Well, the code I gave you doesn't quite work right. Sorry. Let's try this:
[code=python]

dna = 'TACAAATCGGAC'
pat = 'AATC'

for i in indexList(dna, pat):
nex = dna[i + 4:i + 8] # pattern after; to be reserved
here = dna[i:i + 4] # pattern (pat)
dna = dna.replace(her e + nex, here + nex[::-1]) # replace the combination with the last pattern reversed
[/code]
Don't worry about the code in indexList, just know what it does. It returns a list of the indices of the item in the list s. So:

ls = [1, 2, 2, 4, 5, 2, 4]
indexList(ls, 2) will return [1, 2, 5]
indexList(ls, 4) will return [3, 6]
indexList(ls, 1) will return [0]
indexList(ls, 7) will return []

Does that make sense?

[python101]

I modified a little bit the source you gave me earlier, it worked quite well (only inversed the pattern we enter, not the next pattern after the pattern we entered). The new source code makes more sense. Thank U very much.

[python101]

The program seems to reverse only the first next pattern but not all in the sequence.

For example

dna = 'AACCTTGGAATTCATTAACCACGGAATTCATT'
pat ='AACC'
will only reversed to
dna = AACCGGTTAATTCATTAACCACGGAATTCATT'

[ilikepython]

The program seems to reverse only the first next pattern but not all in the sequence.

For example

dna = 'AACCTTGGAATTCATTAACCACGGAATTCATT'
pat ='AACC'
will only reversed to
dna = AACCGGTTAATTCATTAACCACGGAATTCATT'

I'm pretty sure it works:
[code=python]
def indexList(s, item, i = 0): # Thanks to bvdet for code
i_list = []
while 1:
try:
i = s.index(item, i)
i_list.append(i )
i += 1
except:
break
return i_list


def getNew(dna, pat):
for i in indexList(dna, pat):
nex = dna[i + 4:i + 8] # pattern after; to be reserved
here = dna[i:i + 4] # pattern (pat)
dna = dna.replace(her e + nex, here + nex[::-1]) # replace the combination with the last pattern reversed
return dna


dna = 'AACCTTGGAATTCA TTAACCACGGAATTC ATT'
pat ='AACC'

print "OLD: %s" % dna
dna = getNew(dna, pat)
print "NEW: %s" % dna
[/code]

[python101]

Thank you very mich, I have a problem when running the source code.

For example,
[code=python]
dna ='AGGTGGTTAGGTGGTT'
pa='AGGT'

#the output is fine
result='AGGTTTGGAGGTTTGG
[/code]
however, if it changes the last pattern of the dna
[code=python]
dna ='AGGTGGTTAGGTTGGT'
pa='AGGT'

#the output is not good
result='AGGTTTGGAGGTTGGT
[/code]

I'm also looking for a code without using while. I want something very basic since I'm just a beginner.

[bvdet]

Thank you very mich, I have a problem when running the source code.

For example,
[code=python]
dna ='AGGTGGTTAGGTGGTT'
pa='AGGT'

#the output is fine
result='AGGTTTGGAGGTTTGG
[/code]
however, if it changes the last pattern of the dna
[code=python]
dna ='AGGTGGTTAGGTTGGT'
pa='AGGT'

#the output is not good
result='AGGTTTGGAGGTTGGT
[/code]

I'm also looking for a code without using while. I want something very basic since I'm just a beginner.

The while and for statements are the two basic loop constructs in Python and are good for a beginner to learn. I made some changes to ilikepython's code:[code=Python]# Reverse the sequence(s) in 'dna' following the substring defined by 'pat'def getNew(dna, pat):
def getNew(dna, pat):
for i in indexList(dna, pat):
j = len(pat)
revstr = dna[i + j:i + j*2]
dna = revstr[::-1].join([dna[:i+j], dna[i+j*2:]])
return dna
[/code]You still need function indexList().